Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig91
Contig Information
Length 419 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16e07    rwhem16e07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_12907 [Oryza sativa Indica Group]
Score 205
Evalue 4.99535e-15
Total Hit Count 6
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig91
CTGAAAGCTCTTGTGGCACTTGCAAAGTCGGATAAAGCTGCGGGGTTTTTGGACAAGGCAGGTGCCTACGCCATCGTCGCCTCCACTCCGAATTCCCCCG
AATATGCCGAGATTGAGGCCTGCAAGACTAGTCTTCTCAAGACGTTTGATCAACTGAAGTCGTGATGGGAAATGCCTGGGTGGATTTCTCTACATGTTTT
CTCCAAACTGGACTTTGACTGGGCCATTATTTTGATTGAAACAAGAAAACAAGCTCGGTCCATCGTTTTGTCTTCCTGAGCGCTCAGTTTGTCACACCTC
GGTCTTGTTGCTGGCGTGGGGCATTTTGTTCCAAGCACTCAACTTTGGGGTACCTTCTTTGTATGATACTGGCAATGGGTCTATGCAGTTCTTTTTGGCG
ATGGGAGTGAAAAAAAAAA
page-top