Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig90
Contig Information
Length 566 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem17i19    rwhem17i19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0815000 [Oryza sativa (japonica cultivar-group)] >gi|47847878|dbj|BAD21671.1| putative ribosomal protein L37 [Oryza sativa Japonica Group] >gi|113538029|dbj|BAF10412.1| Os02g0815000 [Oryza sativa (japonica cultivar-group)] >gi|125541603|gb|EAY87998.1| hypothetical protein OsI_09420 [Oryza sativa Indica Group]
Score 477
Evalue 2.26945e-46
Total Hit Count 298
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig90
GCGGCGCGGAGGCGACAGGCGAAGGCGAAATGACGAAGGGAACGGGCAGCTTCGGCAAGCGCCGGAACAAGACCCACACGCTGTGCATCCGCTGCGGCCG
CCGCAGCTTCCACCTGCAGAAGAGCACCTGCTCCTCGTGCGGCTACCCCGCCGCCCGCATCCGCAAGTACAACTGGAGTGTGAAGGCCATCAGGAGGAAG
ACCACCGGCACCGGGAGGATGAGGTACATGCGCCATGTGCCCAGGAGGTTCAAGAGCAACTTCAGAGAGGGAACTGAGGCCACACCAAGGAGCAAGGGAG
CCTCTTCCAGCGGCAACTAGGCGTGGCGGCCTTAACTTGTTACGCTAGGCGGAGCCCTGATCACCAAACTTAGCTTTTTTGTTGCTTTCTACTGGAACTC
TATGTTTCTATGTCGAGAGGCGGACGATATGATGCCTGGTTATGTTATTTGCACAATTATCGTGGACGTTAATCCTTCAGTTTTGAATGTTGAATTGTGT
CGATGTCCTGTGTTAAGATGCTCTGCATCTCTTGTTCAATGCGCTATTTGTGATGAGGCTTTTTGT
page-top