Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig89
Contig Information
Length 524 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem7i12    rwhem7i12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit DRP2 protein [Triticum turgidum subsp. durum]
Score 383
Evalue 1.46113e-35
Total Hit Count 21
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig89
GTCGTTTCCGCCACTGTTATCTCTGCAATTGTTGGAGTCATGATTGCTACTGGTTGGATCGGATTCTTTTGGATGATTTGGTTTGCCGCAAGGAAGAGCC
TGGACCTTACCAAGCACTCAATCGGCATGACGACCTCTGCTATGCAGTCGTATTCGGCTTCCCGGAGTGTGGGGCAGAAGCTCACAGACTGACTGAGATA
GCAGCAACTGGTTTAGCCCCAATGCTCTGTATGTTATCGCGTCGTCTTGCCGCCTCGCTGCCCTGCTGTTGTTGTGTTATATGTGCTGCCTAAAGCGTGC
CGTATGTGTATCACTTATTTCGAGTAGAGGACATGAATCCGTGTATAGTTATCCCGGTTTAGCGTAAGGTACCACCACTCGCCCCTGAACTTTCGGCACC
CTGTGTTGTAGTATACTCATAGTAACGAATAAGGCAATAATGCCGGCTGTGTTGGCGAGTGCGGGCTAGGTTGTGGTTTTGTGCTGTAAATGAAGCTATT
CTGTCTGGCTCTGTTGTGAGGCAT
page-top