Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig86
Contig Information
Length 673 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem17i06    rwhem17i06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative cyclin-dependent kinase regulatory subunit [Triticum aestivum]
Score 368
Evalue 1.50297e-33
Total Hit Count 210
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig86
GAAGTACTTCGACGACACCTTCGAGTACAGGCACGTGGTCCTCCCGCCGGAAGTCGCCAAGCTCCTCCCCAAGAACCGCCTCCTCGCCGAGAACGAGTGG
CGCGCGCTGGGCGTGCAGCAGAGCCGCGGGTGGGTGCACTACGCCGTCCACCGGCCGGAGCCGCACATCATGCTGTTCCGCCGCCCGCTCAACTACCAGC
AGCAGCAGGACGCGGCTGCTGCCGCCGCGGCGCAGATGATGCCCAAGTGATCGGCCCCAGCGAGGGCAGTGGCGACCGGGGGTTGGAACTCCTGAAAACC
CCAGGCCCTTTTGATCTCTAAAAGGGCGATCGCACTGGTTTGTCTGGTCAGGATCTAGTTGTGTTGGTGGTGTCCACCATGTGTTCGTGGAAATGCCTGG
GAGGAACTTGCAGTGTGTTAGTCTGTGTTATTATCCTGGATACTGTTGAATGCTACCTGTTATGTGATGCTGGTACTGTTGGTAGATCTCCCCGTGATGA
TCTGTTAGTGTTAATGCTTGCTTTACTGTTATCTGGTTCCTTAGATTAGGTGTATGGTGTTCATGTGATAGTGAATCTTATGTTTAGCAAGAGGATTTGG
AGCACTGGTTATGGATGATCTATGCACCGTCCAGACTAAAATGCACCTCCTTTGCATGTTTGGTACATCATCA
page-top