Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig85
Contig Information
Length 316 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem7j01    rwhem7j01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase [Hordeum vulgare subsp. vulgare] (no hit)
Score 915
Evalue 6.05504e-97
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig85
CGACTGGGGAGATTTTGACGGCAGCCTGCAAGACTTGTGTAATGCAAGTATATCGCTCACGATGCCAGCATACTCTTGATGGCAATATTTCACTGCAGCC
TTTTATTCGTGTGTTCCGATGTCAGTTTTACATGTTCACAGTTTGCATGCCGTCCTACTCTATTTACTTCTGCAATGGTTTTACTCTGGATTTTCGTTCT
TAGCAGTAAGTCTCTGGATTTTCGTTGAGAATCCGTGGCAAGATTTCTCTACGGATTTGGATTCTACCAATGATTGGCCATTTGGAAAGGAAAACGCTTG
GTTTCTAAAAAAAAAA
page-top