Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig84
Contig Information
Length 701 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem17h23    rwhem17h23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase [Hordeum vulgare subsp. vulgare]
Score 915
Evalue 6.05504e-97
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig84
TTCGCCACCATGGACTCGCCGCCCGAGGGCTACCGCACCAACGTCGGCATCTGCCTCGCCGACCCCTCCCTCACCAAGATTTTCTCCGCGTCCAGGATCG
ACATCCCCACCGCGTGGCAGATGCCTCAGGGTGGAATAGACCCAGGGGAAGAGCCGCGAGCAGCTGCCGTTAGGGAATTGAGGGAAGAAACTGGTGTTAG
ATCCGCCGAGATCGTCGCCGAGGCCCCCAATTGGTTGACATATGATTTCCCCGCGGATGTCAAAGACAAGCTGAATGCTAGGTGGGGAACAAACTGGAAG
GGCCAGGCTCAGAAGTGGTTTCTATTTAGGCTTACCGGGGGTGATGACGAGATCAACCTGATGGGCGATGGATCTGAGAAGCCAGAGTTCTCTGAATGGG
CATGGATGACCCCTCAGCAAGTGATTGAGAAGGCTGTTGATTTCAAGAAACCTGTCTACGAGGAGACACTGAAGCACTTCGCCCCATATCTACAGTCAGA
TCCAACGGCTTCGTCGTAGATTTGCGCAGCCACCCACAAGTTCCACATATCTAGAGCTGTGCGTGCCATCAATAATTTGTCGAAAATGTACTGGGGCCCG
CGTGAGTATTTCTAGAACGTCTGGCGTGTCTGCCAACACCGACTGTTATCCCAGCATTGGATCCCGATAGCCTGATCATGCTCAACGAGGTGCGTGCGTG
T
page-top