Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig82
Contig Information
Length 560 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem17h20    rwhem17h20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_23086 [Oryza sativa Indica Group]
Score 510
Evalue 3.27246e-50
Total Hit Count 56
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig82
CTTTGGGAGCTTAGCCTTCTGCAGAAGCATTATGATGAAACTGTTAGTGGAATGGCTTCAAATATCTTGAGCATGGCAAATCTGAACGCCACCCAGAATC
CAGTTCAACTTTCTAGCTCAAATCCTCTTGAAGCATACAAAGACTTGTCGATGGGACGTGAATTATCAAAGCCAACCCACAAAGTGTCACAGACATTGAA
GTGCAAAAGGAAACGACGCAGTAAGGAGTTTGTCGCTCTAAGTCCAGATGTGCTCGAGAAGGCAGATTGCACGGTGGGCGAAGATGAACTGAGAGAGAAG
TTGCAAAGTCATTTCGCGGTACTAAGAGGCATTTCCGAGAATGAGAGATTGAGGACCGAGTTGAACCATGCTTTGTCATCCATAAACATGTACAAGGAAT
ACAAGAAGCAGAAAAAGGTAAGTAAGAAATCAAAGAAAGCTGCAAAGGCTTAGTTGTCTTGTGTTCTGTGGATTTTTCCCCAAACTTGCGGTAGGTGTGC
CCCTATTTTGTTGTAGCATCACTGTATCGATTTATCGTAGTTCCCTGTGACACATTTGCG
page-top