Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig81
Contig Information
Length 442 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16h17    rwhem16h17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit nucleolar RNA-binding Nop10p-like protein [Oryza sativa Japonica Group] >gi|47847676|dbj|BAD21457.1| nucleolar RNA-binding Nop10p-like protein [Oryza sativa Japonica Group]
Score 326
Evalue 4.64736e-29
Total Hit Count 153
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig81
CCGCCTCCGCCTCCGCCAGTCTCCTGGTTGATTCCGGCGCCTTGAACCAAGATGTATCTCCAGTACTACATCAACGAGAAGGGCGTCAAGGTGTACACCA
CCAAGAAGGAATCCCCTCTCGGTGTGCCGACGCAGTCTGCCCACCCAGCTCGTTTCTCCCCGGATGACAAGTACGCCCGTCAGCGTTACCTGTTGAAGAA
GAGGTTTGGATTGCTGCCAACCCAACAGCCAGCACAAAAGTACTGAAGCACTGGATGGGTCCTCCTAAGAGATCTGTTTTCTTTGCTGAATGCTGTTTGG
AGTGTAGATTAGCTATGTGAAGAGAGAATCATCACCGCTACTTATCTTGCTTGTTATTGCAGTACCTCTAAATGTAATGTTATGCTATACGATGGATCGT
ACTCTTTTGTACTATCTGCTCTCTGTGTGACTAAAAAAAAAA
page-top