Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig80
Contig Information
Length 453 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem7k03    rwhem7k03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit CzcB family cobalt/zinc/cadmium efflux transporter membrane fusion protein [Janthinobacterium sp. Marseille] >gi|151281930|gb|ABR90340.1| cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family [Janthinobacterium sp. Marseille]
Score 76
Evalue 4.59875
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig80
GCACACAGAAGTAACACACGCATCCTTCCTTGCTTCCTTCAGGCTTCAACCATGGCTCTCCTCAGAAGCCTGGCTGCGTTCTTGTGCGTGATGCTGGCCT
CCCTCGTGTTGGTCGCACAGGCCGTGCTCGCCGCCAGAGGCGATTTAAGCAGCGTGAAGCGAGACGGTGTGAGGGGAACCTGGGCGTCCCCTTCCTACCA
GGTGCGGCCGGGGCCGCTCCCGCGCTATCCTCCAAAGTAGGCTCGAGGCGATCTATGACAAGAATGGGAATACAAATATGCCGGTCAAGAGTAATTTAGT
TATTTGTTACTGAGCAGTGAGCGTTTGCGGCCGATATAAAGATACCAAAATGCACGATTGTATTTGTATGTTAGTTCATCCCGACTTATCTAAGATGTTG
CTACAACCATATGCGAATAAACAACACGTAGCAACGTTTGTGCAAAAAAAAAA
page-top