Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig78
Contig Information
Length 1062 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16h20    rwhem16h20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_033965 [Oryza sativa (japonica cultivar-group)]
Score 215
Evalue 1.85914e-15
Total Hit Count 15
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig78
TGTTTTGTTGAGAAATTTTATGATTTGCCCAAATGATTATGGACCGTACATTGATAATGATCTAATGGTTAGGATGATGCATCATTTGATAATTCAAGAA
AATGTCGTGTCTTTACAGAAATGTTCAATTCCCCCTCAGTTTGAACTTGTAAGGTATTAATTTTTTAAAAATTCAAACTTACCTAATTTTCACCAATTTT
ATAGAATAAAACATAAATATCTACTATAGAAAATCATTATCATTAGATTCATGATGAAGTATATTTCCATATTTGATTTATTTAGTATTGTAGGTGTTAG
ATGTATTTTGCTACAGATTTGATCAAACATAGGAAACTTTGACTTTTGAAAATTTAATTCATCTTATATTTTGACACACATGGAGTAGTAATCGCTGGGA
CCAGATCCATGCACCATCATCTGAAACCCATGTATTCATGAGGTGTGATGTTAATTTTAACAAATCTGCCCATGGACAGAACCTCGATACCATGATTCAC
AGACCAGCCCACATAGAATTTCTGTAGACTGACATATGCGCCGAGCTCATCTTGTGGTATGTCCCTGAACTTTTCTGATGACAATGCTCTTAGTTGGGAT
GCCATCAGGCTCCAAACCAAACCAAAGCAAACCTGGGGAGCACTTTACTTAACAATAAATTAAGATAACTTTTGCATAAGGTTTTGTTGTAATTCGTTAC
CAAGATGGGTAGCACTGTATAGTTTCCTAGCAGCAACATTTGGCCAGCTTCTTAGATTTTATCTGCATGAATAGTAGATTTTCTCATTTTGATTTAGAAC
ATTGTAAATGTTCACGTCAGCTGCCAGATTAACATAATGGAACGTCTCAGGTGTATTTGAAGGTTGCCAGTTTAGGTGGGCCAAACAACCAGTGCGCTGA
GGTCAAAATAAGCATGACACCAGCTTTATTCTTTTAGGGGTCGCCTACATGATGAAGGATGCTCAGGCACACATCATTGTTGGGTTTTCGCATGTCATGT
CATACTTGGTCTGTAACTGAATCTTGAGAATTCATTTGTATGACCTTGATGTACCAGACGTG
page-top