Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig828
Contig Information
Length 467 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 4 Clones [Download: CSV  ,  FASTA ]
whfl29c07    whfl49d16    whfl45n23    whfl10b03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0817700 [Oryza sativa (japonica cultivar-group)] >gi|29367431|gb|AAO72588.1| 3-ketoacyl-CoA thiolase-like protein [Oryza sativa (japonica cultivar-group)] >gi|47847747|dbj|BAD21525.1| putative 3-ketoacyl-CoA thiolase; acetyl-CoA acyltransferase [Oryza sativa Japonica Group] >gi|113538054|dbj|BAF10437.1| Os02g0817700 [Oryza sativa (japonica cultivar-group)] >gi|125541634|gb|EAY88029.1| hypothetical protein OsI_09452 [Oryza sativa Indica Group]
Score 430
Evalue 4.16754e-41
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig828
acCCCATCCCCATTGCTGCCCAGCAACAACACGCCTCCCTCCCGCGACCCCAAAATCATCAGTCAGCGCGAGCGAGAGATCTCTCCCTGCTTCTTCTTCC
ATGGAGAAGGCGATCGACCGGCAGCGCGTGCTCCTCGCGCACCTCCTCCCCTCCTCCTCCGCCGCCCCGTCCCGGATATCCGCGTCGGCGTGCGCGGCCG
GGGACAGCGCCGCCTACCAGAGGAGCTCCTGCTTCGGGGACGACGTCGTCATCGTCGCCGCCTACCGGACGCCGATATGCAAGGCCAAGCGAGGGGGCTT
CAAGGACACGTACCCGGAGGACCTTCTTACTCCTGTCCTCAAGGCTGTCCTGGACAAAACTGGAATCAACCCAGCTGAAATCGGCGACGTTGTGGTCGGG
ACGGTGCTAGGCCCAGGTTCTCAGCGTGCGATCGAGTGCAGGACGTCATCTCTGTTAGCTGGAattc
page-top