Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig88
Contig Information
Length 467 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem17i14    rwhem17i14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0839700 [Oryza sativa (japonica cultivar-group)] >gi|15623831|dbj|BAB67890.1| putative ubiquitin carrier protein UBC7 [Oryza sativa Japonica Group] >gi|21104618|dbj|BAB93210.1| putative ubiquitin carrier protein UBC7 [Oryza sativa Japonica Group] >gi|113534286|dbj|BAF06669.1| Os01g0839700 [Oryza sativa (japonica cultivar-group)] >gi|125528325|gb|EAY76439.1| hypothetical protein OsI_04373 [Oryza sativa Indica Group] >gi|125572583|gb|EAZ14098.1| hypothetical protein OsJ_003923 [Oryza sativa (japonica cultivar-group)] >gi|215679024|dbj|BAG96454.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215704452|dbj|BAG93886.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767293|dbj|BAG99521.1| unnamed protein product [Oryza sativa Japonica Group]
Score 85
Evalue 0.421615
Total Hit Count 21
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig88
GAGAAAAGAGGGCCGAATTCAAGAAAAAGGTGAGGAGCCTTGTTCGCAAATCTCAGGAAATGCTCTGAAAAAGGAGGATCATCCGGGGGAGTCCACAAGC
GCTGCAATTCTCTTGCTTTCACCAAATGGGGCACCTGATGCCAGCACTTGAACTTCTCCCCTGTTTATTTTCCGTTCAGCGTTGGTCGAATGGTGATGTT
GGTCTTGTCTCTCCGAGACACTTGGGGTGCTGCCTATTATGAACTCTCGATTGTATTGTGGCATGGAGTTGGTCAATGTCAAGAAGTATTTTCGTGTGAT
GCCACTTAATCGTAGTCATCGCCGTGAACCTCATAAAAAGGAAATTGGCTGTTCGTTGAATTGATCCTTACCCAAGAATCTGCCCGCGACATGGTTATTC
TGAATGTTAGCTCGTTCAGTGTATAACTGGTATTAATTGTACTTGATGTTAGTANTACCANAAAAAA
page-top