Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig76
Contig Information
Length 195 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem17h10    rwhem17h10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit EF-hand Ca2+-binding protein CCD1 [Triticum aestivum]
Score 104
Evalue 0.00263091
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig76
CAGCCCCGCCGGTGGCTCGACGACGCCGTCGCCCAGGCCTCCCACTTCCTCTTCACCAGCTAGGCGGAGCATCTGGTGTCGATCGGATAGGAAATTAATC
TTCTTCTTCGTTGTTGTTTTTTCTTCTCTCCCCCGCTGTTCATAGAGTCAGGATTCAAGAAAAGAAAGGGCACTGTCGATTGGTTAAAAAAAAAA
page-top