Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig73
Contig Information
Length 1137 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem7k09    rwhem7k09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_10853 [Oryza sativa Indica Group]
Score 350
Evalue 4.55652e-31
Total Hit Count 227
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig73
ATTGCGTCTGATTTACTTCCCATTTTGGATAATCAAAACCTCAAGCTACCAGTCCATCATATCCTTGAGGAAGCTGGATAGGTTCCCAACGACCTTGTAC
TATATTTTCAACACAATGCTTCTCACATTACTTGTGTTTCATGTGTATTGGGGGAAACTCATATTTTCAATGATAATGAAACAATTGAATAATAAAGGAA
AAGTTGGAGAGGATGTTCGATCTGGTAAGGTTTCATTTCTTTGCCGCAATCACTTGTTTGATTTGAATTCACCCTTTTTCATCCTGACTGACGTGTTTTT
TTCACGAACTCACAGATGGTATTAGGATATCTACATAAATATTTTTTTCTTGTGAAATTTGGGTTCCCCCCATTCTCTTCCAGATAATACAACGTCTAAC
TTTGTCGCCAAATTCCTGCATGAAACAGGAGAGCCCTGCATAATCAGTAGGGAAGACCCATATGGCATACATAATGAAATAATGAACCACCCATTTCAAT
TTTGAATAGTTGCATGAATAGTACAGTCATAATATCACATATTGATCAGATTGCCTAATGGTAACTAGCTCCGATACATTGTTTGGTAGACCCCCTTCCA
TCATAATCAGTTATAAAGATTTGAATTGCACCAGAAACTACATTAACCCAGGTTTTTGTTTGGTAGACCCCCTTCCATCATAATCAGTTATAAAGATTTG
AATTGCACCAGAAAACTATATTAACCCAGGTTTTTGTTAGTTGTGATCATTTAAATGATGAATTTCTTCACAATGCAGATTCGGACGATGATGACTGATG
GGGGTGGTTCTTTGACAATTGTGATGGGCCATTTCTTTGCTGGTACCTTGCCCTGTACTTACAACAGTAGATTGTGTTGGTCCGCAAGCTTGTGCTAAGA
AAGTTTCATTTCTGTATATTACCTTATGATATCAAAGATTGCTAGACCAAGAAACTGAGCAGGTTCTATACATAACGGGTATAGCTAGCAACTTACTTGA
AGGTCCCTTCATAATTTTTGGTTCATCTTTCCTTGTTAGTAGAAAAGGCTTAAGAGGTCGTTTTCTGTGGCTTTTCCGCAGAGCTTAGAAGCTCCTCTCT
ACCATGTCTTGTATACTGTGACTATGAGTAGGTTAGC
page-top