Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig70
Contig Information
Length 646 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem7k13    rwhem7k13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|219887339|gb|ACL54044.1| unknown [Zea mays]
Score 230
Evalue 1.3879e-17
Total Hit Count 193
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig70
CAGCGCCTTGAACATTCAATGATGGCTTATGTGAACTTCAAGAAAGAGCAAGCTACCAAGAAGGAGAAAGTGTCACAACAAGGAAAACAACCCTCAATTA
CAGAATGCTTGGAGGTCTTGAATGACATGGATGATGTGCCCGACGAGGTGAAAATCTTTGCCTCTGATGTTTTCAAAGATGCAGCAAACCGTGAGATTTT
CCTGGGTTACAACTCAAGGTTACGGGGTATGTGGTTAAAGAAGGAAGTCGGCAAGATTAGTCCTCAGTCTTCTCCATCTCAGTTTTCATGTGGCGGTATT
TCTTCAATCAATCTTGTGCTCTAATTGAAGGTGTGGCCTGCACCTAATTATCGTTACAGATGTGGGAATCCCATGGCAATTTTGTGAAATTCAACCGCTT
CTGCTACAATCTGCTCACCATCATAGCAAGTCCAATGTTGCTAATTCTTGCAAGCAATTCATTTCGTTAAGGCCGTAGATGTTTCTTGCAAACAATCTGG
CAAGATTTTCTGTAATAATTCTAGAAAGGAGTGACTGGTTCTTGTGTTTATGTTCAGATTTCTAAAGCAGATGAATGATGTTAGCTATTAGTTGTTGGAT
TTTGAATCAAATATCTCTCATTTGTAAAGGATAAGAATCAGAAAGA
page-top