Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig66
Contig Information
Length 466 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16f21    rwhem16f21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit CI2C [Hordeum vulgare]
Score 269
Evalue 1.9449e-22
Total Hit Count 236
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig66
GTCCATTTAGCTGGTGAGCTGTGCTGGCTCGATCGCATAGTCAGGGATGAGCTATGGCGACGCCCCAAGATGCCTCGCCGTAGAGGACGAGAAGAAGACG
TCATGGCCGGAGTTGGTGGGGAAGTCCATTGAGGAGGCTAGGGAGATCATCCTCAAGGACATGCCCGAGGCTGACATCGTCGTCCTCCCTACCGGCTCGG
CAGTGACCATGGACTTAAGGAGCAACCGTGTCCGCATCTTCGTCGACACTGTCGCGACAGCTCCTACCATTGGCTAGCTAGATTTCCTCGCTAGGAGCGA
TGTGCATTTGGCAGGCATCCCGTGTGCTGATGACCAAGTAATAGTTCAATAATGGATGAATAAGTACATGCTGACCGCCAGCATGTTATTTATGGATCAA
TGTACTTTTTTTGTTTGGGTTATGAAAAGATGTGCTCGACTGGTTAATTATTTGTANTTTGCGTTA
page-top