Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig63
Contig Information
Length 556 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16f24    rwhem16f24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein BURPS1655_A1459 [Burkholderia pseudomallei 1655] >gi|184210020|gb|EDU07063.1| hypothetical protein BURPS1655_A1459 [Burkholderia pseudomallei 1655]
Score 83
Evalue 1.03128
Total Hit Count 37
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig63
CGGCGATGGCGCTCGTGGGTGTCATCCCCCTCCTTGGAGGCGTCGCCGAGGTGCATTCGTCATTTCCCTCGTTGTGTGGAGTTGGTTGTTATCTCTAGGC
GAAAGCCTCGATTCGATCGGATTGGCATGATGGCGGCGTCTCCGACGTCGTTACTCTGTTGAGAGCATCATGTTTGGAGACATGACTTGGTTCCTCGTTG
CTCTCCTCCGGTGTTCATCGTGGTCCTATTTTGATCCTCGGCGGCGCTATGTACGGCCATCGCCGGTGCGTCCAAGACGATGTCTTCCTTGGATCTGATC
AAATCCTGCCATTTCACTTGCCACCTTCTCTTAGGCATTCGGGGTGAATGGTGCGTCGACAAGCAAAGTTCGGTGGAAGTGGTTGGCCTTTGGAGGTGCT
CGGCGTTGGTCGAGACGCGATGTCGTGATCTGTTAGGACATGCGTGTTTGCTTTGTAATTTTTGTTTGGTCGTTGGTGGCTGTCCGTGGACATGCCTGGT
GGTGTTTGTGCTACGCTCGTTGTTCGCAGCGAGTGATAGTCTTCTTGTACTGCAAT
page-top