Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig62
Contig Information
Length 929 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem17f19    rwhem17f19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RAB1-like [Poa pratensis]
Score 1009
Evalue 1.28967e-107
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig62
AGAGCGAGCGAGACGCCAAGAACTCGGACGGGGAAGTCGTGAGGCCGCCTGCCTCCGCCCGCCCAGGACTCGATCTCGATCCCCGCCGACAAGCGGATCC
CCCGTCCTCCCGCCCGCGCCCGCCCAGGATTCGATCTCGATCCCCGCCGACAAGCCGATCCCCCGTCCTCCTGCCTGCGAGAGAGATCGGACGCCGCGGG
AGCGCCCGGATCCCGCCATGAATCCCGAGTATGATTACCTCTTCAAGCTTTTGCTTATTGGAGACTCAGGTGTTGGCAAGTCATGTCTGCTGTTAAGATT
CGCTGACGACTCATACCTGGATAGTTACATCAGTACTATTGGAGTTGATTTTAAAATACGGACCGTGGAGCAGGACGGAAAGACTATCAAGTTGCAAATC
TGGGACACTGCTGGGCAAGAACGTTTTAGAACTATTACCAGCAGCTACTACCGAGGGGCCCATGGGATTATTATCGTCTATGATGTGACAGACCAAGATA
GCTTCAACAATGTGAAGCAGTGGTTGAACGAGATTGACCGCTATGCCAGTGAGAATGTGAACAAGCTTCTTGTTGGTAACAAATGTGATCTGGCTGACAA
AATAGCTGTGTCATATGAAACAGCAAAGGCATTTGCTGATGAGATTGGCATCCCATTCATGGAGACCAGTGCAAAGAACGCCCTGAATGTTGAACAGGCA
TTCATGGCCATGGCTGCTTCGATCAAGGATAGGATGGCGAGCCAGCCAGCCGCAAACAACGCTCGCCCAGCTACTGTACAGATCCGCGGGCAACCTGTCG
AGCAGAAGGCCAGCTGCTGCTCTTCTTAGAAAACCATGCAAACTTGTTGATGCTCCGTCACCTTTATACATGTTTTCTTATTTGTTTTTACTTGTTATCT
TTATTCTTTTCTTTCTAGTGTACCTGCCT
page-top