Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig61
Contig Information
Length 1066 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16j07    rwhem16j07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_031752 [Oryza sativa (japonica cultivar-group)]
Score 95
Evalue 0.153498
Total Hit Count 15
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig61
ATCTGGCATCTGCCCTGTACAATCTGGTCATCCTTTGAGTCATCATCTACTTGGACCTGTGCGCGTACATTCTCCTTTCGGTTCCTCCACTTAGACCTTG
CAGATATGGTCCTTTGCGTCCTCCACTTGGACCTGGGCGCATGTATGTACATGGGCCTCACTTGTGTGCTGGTTTATGTGAAATCCCAGAACTTCTCAGA
GAGAGTGCAAGTGGCAGGGTGATTGATCGGTGTAGGCTTTTGATCAGCAGCAACCCTATTCCCCTAGAATCAGTTGGGGCGTCTGTATCAACTTTGAGCG
GCCAGCCACTCCTGGAAATATTGGCGCTCCACACCAATTTATGCAAGATCAATAGCATTGGAATTTATGATGATCGAGGTGGTGTTTATATCTACAAATA
CAAGAACGGGGAGAAGGAACGGTTTATTGACAAAAGGGATCTTTGGCTGTCTAAGCATACAGAGGGAGGACCTTATGATCTCGTGTACAAACTTGTTCCC
ATTGGCCCGAGCCGTGCCATGACGGCTAATGCAGAGTGCTGGCTACTTGAGGCTGATGTGCCGATAGAGTCTTCTTTGCTGCCTAAAACCTGTGCAACAA
AGGAAATGGCAGGTGGAGTGTTCAAAATGATATTAGATCATAACGAGGAAACAGTTGATGAAGCTAAGACCGGTATCATCTTAGCCAGGGGAGGATTTAT
ACATATTAGCTACGTGGTATTCAGAAATGCAGTGAGAGCTTCAGTCAGATTCCTAGTGCATGATTATCACTTGTTTCGTCCTTATTATGTGAATGGCGAG
CTGGCTTTACATGTGGGAGACCTTCCTATTGGGTTAACTATTTTCTCAAGTCAAATTGAGGATGGTAACTGTTTCACGCCATGTGATGCTGCTGGACAGG
ATTTCATGCTTCCTTTAACTCGGAGAGTTATTGCTTTACCTGTTGATTCGCCTGTCCGCCTCAAGGGAACTTTGGAGATTGGAGGTAAATCCATGGCTGT
AGACCAGTCTCTTGTTCTCAAAAGTGGTAGCACCCAGGTTAAGTGGTCGATGCATGCGTCTCTGAT
page-top