Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig60
Contig Information
Length 797 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem17f16    rwhem17f16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_011414 [Oryza sativa (japonica cultivar-group)]
Score 608
Evalue 3.11897e-61
Total Hit Count 123
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig60
ACGTTCGCAGTGGCTGGATGAGTGGCAGAAGCTGCCATACATCTCGCCGTACGAAGATGGTTCGCACCTGGCTCCCAGGAGCGACATCACGGAGAAGAGG
ACTGTGGCGGTGCTGCACGAGGCGCTCAGCCTCACGGTAGGGAAGAAGATGGAGAAGGAGGTTTTGGTCAAGCTTGGGGAGGCTCTTAGGCTACCACCAG
GGTTCAGGAAGGTGCTCGCGAGGCACCCAGGTATCTTCTACCTGTCTCATAAGCTGAGGACCCAGACGGTGGTGCTCCGGGAAGCCTACCGGAGGCATAT
GTTGGTGGACAAACACCCAATGATGGGGATAAGGTATCAGTTCCTGCATTTGATGCATATGGGGAGGGAGGAGGCCGGTAAAGCAAAGGGCAAGGAGAGG
AAGACAATTCGTGGCGACCAAATGATGGGAGACGAGTATGGTGCAGATGGGGAGAATGAGGATGACTACGATGATGAGGAGGATGAAGAAGAGGATGAGG
AGAACATCGAAGCGGGTGTTGCTTCAGAGGAAGAGGAGAGCGATGACGAGGATACAGAGAACAGGGGAGAAACTGGAGAACCGCAACAAGCCGCTAACTG
AAACAAGAACCTGCATCATAGCTGGTCTTGTGATGTTGGTGGTGATGTGCGTTTGAATTGCATGAATATGCTTGAAGGCCTAGCAACATAATGTACAATC
AGCTTCTATAACAGGTACCAAACCTACTAGAAGATGGTCCTTATTTTTGTGTAANCTAGGTTGTGAAGTAGCTGGTGATTATTAAGTGAAATCATCC
page-top