Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig58
Contig Information
Length 521 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem17f11    rwhem17f11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays] >gi|195625484|gb|ACG34572.1| hypothetical protein [Zea mays] >gi|195628768|gb|ACG36214.1| hypothetical protein [Zea mays] >gi|195650173|gb|ACG44554.1| hypothetical protein [Zea mays]
Score 303
Evalue 2.70561e-26
Total Hit Count 125
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig58
GAGGATCGAGAAGGGGCGAGGGTGGTTGTTTGGACGGAGTTGGGGACTATCGATCGATCGATCGGAGGCGGGGCGGCGGGATGACGCGGGGGAAGCAGAA
GATCGACGCGCAGCGGAAGAGCGCGTAGAAGAACCAGAAGTCCAAGGGGTCGCAGCTCGAGGCCCGCGCCGTCGGCCTCAAGGTCGTCTGCCCCATCTGC
AAGTCTCAACTGGCCAACGAGAAGCAGTTGATTGATCACTATGGATCAAAGCATCCCAAGGAGAAACCTCCAGGTCCATCAAATGCAGAGTGACTGATGC
GAGGCGGAAGCATGAGCTATACTTTGACTGTTTCTGAGGGTTTTTCAATCTGCTCCACACTCGGACGACTTGAGCCTCAGCTTTACCCTATGTAATGCAT
GCATTTCCCCTTGTTCCAGGCAAGAACCTTGATGAGCATGTATTTGCCTTATATGAGTATCTTGTCAAACTGTCAGCATACCTTCAAACTGTATGTGGTA
CAATCTTGGATAAGAGAATGC
page-top