Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig56
Contig Information
Length 850 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16g03    rwhem16g03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit charged multivesicular body protein 2a [Zea mays]
Score 764
Evalue 3.32517e-80
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig56
AGAAGAGGGAGGGGAACATCCAGATCGATCCGTGGGACTCACAGTCCAGCCCAATCCAAGCAGCCGGCCGGCCGGATCCGACCTCCGCCCGCCGCCATGA
GCTTCCTCTTCGGCAAGCGGAAGACCCCCAGCTGAGCTGCTGCGGGAGAACAAACGTATGCTAGATAAGTCCATCAGGGAGATCGAGAGGGAGAGGCAGG
GCCTGCAGACTCAGGAGAAGAAGCTCATCGCTGAGATCAAGAAGGTGGTCAAGCAAGGACAGATGGGAGCTGTAAAAGTTATGGCCAAGGACCTTATTCG
CACAAGGCATCAGATCACGAAATTTTATGCCCTGAAGTCCCAGTTGCAAGGTGTATCTCTTCGTATTCAGACCCTGAAATCAACACAAGCAATGGGAGAA
GCCATGAAGGGCGTCACAAAAGCCATGTCACAGATGAACAGGCAGATGAATCTACCAGCACTCCAGAAGATAATGCGGGACTTTGAGATGCAAAATGAGA
AGATGGAAATGGTCAGCGAGGTTATGGGTGATGCCATCGACGATGCCTTGGAGGGTGATGAGGAGGAGGAAGAAACAGAAGAGCTAGTTAGCCAGGTCCT
CGATGAAATCGGCATCGACATCAACTCTGAGCTTGTCAAGGCCCCGGCTACCGCAGTCGCCATGCCGGTTGCAGCGGGAAAAGCGCCTGTTCAAGCTGAA
GCTGCGGGCGGGATGGACGGTGGAATAGATGATGACTTGCAGGCACGGCTTGATAACCTGAGGAAGATGTGAGCACTGGACTCTGACGGATTGTCCACGC
CCGCAATTCTCTGCCTGTAGTTTTGTACCATAAATGCCACTCCGGCAAAT
page-top