Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig54
Contig Information
Length 714 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16g07    rwhem16g07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 465
Evalue 9.53465e-45
Total Hit Count 46
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig54
GCATGGAGCCCAAAGAGAAGTCCGAAACGACCAGCGCTGCCAGCCCACCTCCACCGCGGCTGGACTGCATAAAGTGCTTCGATGCGCTATGGTTCTGCTA
TACCCCTTTCCACCAGCTGCAGACCTACTACCGCCATGGGGATTTTGACACCTGCTTCGGCAAGTGGGGCGACCTCGTTGACTGTCTCTCGCTCAAGACG
AAGCGGAGGGCGGAGGTAGAGGAGATCCTCATCGCGCGGGAGAAGGCCAAGCCGCACATCTGGACCTTCCGGACTGTCGAAGAGGCGCAGGCGAACTGGT
GGCAGATGTACAAGCACAAGGTGGTGATGTCGTCGCCACCCAAGACTGTAGGTTCTGCTGCGCCTCCTCCTGGATCATCTGGTGCTCTTTCCTGAGAATT
GAAGGTCGGGGGAGCCTACAGAAGCGTCGATTGCGCTTTTGTGCGCCGTGCTTGGACCGCTGGTCTTTGTTCAGACTTGAATGTACCCTGGCAGGGTAAA
TAATTGGAACCTTGGATGGAAAGATACCTTGATCCTGTTCTGTAGATCATGGCAGGCAACTGAACCAAGATGTTCTGGTGGATTGCTCTTTTGCTATTTT
TTGCACAAGCTCTGATGCTAGCTTTTTTGCTTAGTTGCTTATCAGGCATAAATGTTCTCCCTCCTGGTTCTTCAAGCAATTGTTATCTGAATATCACACC
TGCAGCAATGCTGC
page-top