Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig53
Contig Information
Length 313 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem17e18    whem20b20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 252
Evalue 1.77258e-20
Total Hit Count 16
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig53
CTGCTTTCCTCTCGCAAATTTTAGTCCCGCGGTGCTGCTCTGTTCATTACTCCGGCGATCGGCGATCAGTTGTGCACCTGCCGTAGCTGTTGATTGATAG
CGGGCCGATTGAAGTAGCTGCCTGCCATGTCTGGAAAATCGCTTGCAGTGGCGCCGCGGTCTGACCCGGACAACGGGGCGGAGCGGCAGCCGTCGTCGGC
GATGCTCGGGGGCGTCATGGGCTCGCTCCGCGTCATCGAGCTCCAGCTCGTCGCCTTCATCATGGTCTTCTCGATGTCAGGCCTCGTCCCGCTCATNGAC
CTCACCTTCCCGG
page-top