Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig50
Contig Information
Length 636 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16i13    rwhem8b18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit periplasmic sensor signal transduction histidine kinase [Acidothermus cellulolyticus 11B] >gi|117649434|gb|ABK53536.1| periplasmic sensor signal transduction histidine kinase [Acidothermus cellulolyticus 11B] (no hit)
Score 74
Evalue 7.97093
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig50
TACCCACGCCGCCGCCGTTCCCCTCCGGCAACCATGGCTGGGATGGCATCACGCTGCGAAGGCAAGACAACCGGCGACAAAGGCTACTGTAGTGTGATTT
ATTCACCCTATCCACAGTCGTCGCCTCTTCCTCCTCGCCTGGCCGACCTGTTCCAACACTTTGGTCTGGACAAGATCCGCGCGATCATGAACAGTTCTGA
TGGTAAGACGTTCGAGCAAAAGATCGACAAGTTACGAGAGGAAATGAGTGCTTTCGAACGTGCTCGTGATGTATTCTACATCGTCGAGGGCGAGGATGGC
GACGAGGACGACGAAGGCGACGAGGACGACGACGTGGATGTGGACGAGTCGGATAGAAAGCTCTTAGATGATGAAAAGAAACCCGATATCACGAAACGAC
CACACACTCCTATTGGAGATGAGGTGGAATGCAAGAAGCCAAAGATAGCAGAAGGCTCAAGGTGCCAAGGAGAAGAACCTGAGGCTGGAGGGATAAAGAA
TTCCTCCTGGGTCTGATGACAGGGGAATGCAGTAAACACCAGAAGCATCAAAACTATGATCTGGAACAGTATCCTGAATAAACTATTTTCTGGATTATGA
ATGAATTCTGAAGCCATGGGGCTATAAGTGAATTAT
page-top