Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig48
Contig Information
Length 565 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem17e10    rwhem17e10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100216993 [Zea mays] >gi|194697322|gb|ACF82745.1| unknown [Zea mays]
Score 339
Evalue 2.24262e-30
Total Hit Count 130
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig48
GCTGGCTTTACCTGAGATACTTCCAGAAGAACCCACTGACAGGGCTTAAGGGCGACCCAAGTGATGACTTCTCCTTCCCCAGCTTGTTCCCAGATGCCAT
GCGGCCAGTCACAGACCCAGTTGCTAACCTGTTCGACCGGATGTTGTGTGCGAGGTCCAAGCCTTCGGAAATTGCCCTCCCAGTTACCGATCCTACCAAG
GCATCGAGAAGAAGGGAGCGTGGCGAGAGGGTTCTCGAGGAAAGGATGGCCGCGGACCATGCGGCTGACGCCGAAGCCCCAGCCCACTCCGCGGAAGATT
AAGAAATTTTCCCCTGTGCTACGTCGCCATAGTGGCCACGGTCGCCTGCCTCCGTGCTTTGTAACTCCTCGGATCTGTGTTCTGGGGAGCATATTCATTT
TTACAGTGGACCGATGATATGATATTACTTTACTGCCCCTTTTTCTGTTTCCTTGTTTTGAGAATATTGGTTGGTTAAATTGTGTTGTAGTTCCTGATTA
CAGTGAGGAAAGAAGAAAAAGGGTGGCATCCCCTTGCCCCAGATGTTGTAATGTAGAAAAAGAAT
page-top