Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig46
Contig Information
Length 668 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16g22    rwhem16g22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 223
Evalue 9.57905e-17
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig46
TACGCTGACTGCAACTGAGAGGACCCTATGCTGTATTCTGGAGAACTACCAGAGGGAGGATGGGGTTGAAGTGCCAAAAGCACTGCAGCCATTCATGGGT
GGGATAGATTTCCTTCCTTTCAAGCGTCCTCTTGATAGCAAACAAGCTGCTGACTCCAAACCCAGCAAGTCTAAACCAAAGGGAAATGCAGCTTGAGCTG
TAAAAGGGGAGAATGGAAGCTTATTTCCATCAGGCAGATAATGATACATCCTTTTGTTAATTTCTGGGTCGTCTGTGGTGTCCCATTTCCTTTTAACAAA
AAGACATCGTGGCGCTATATTTCATTAAATGAAGTCGAAGTTACAAAGCTAGGGCAACCAAATGAAAAAAGGGAAACCGACACCGGCAATCGGGCTATAC
AGCCGGCTGTAACCACATTCATGGCGGCTTGTATAATCTTTCTAATTAGCACAACCTGGCATCTGGCCTCATCCGCGATTCGACTGAAGATCTGGACGGC
GCAGCAGTTTGAATTGGTGCCCCATTTTGCATGTTCTGTTTACAAAACATTGCAATCCAGGATATGTGCTCAGATTTTACCAGAAAGTACATTAATATCT
TTTCATGATTGTAGTTATTAGTTTACGTCACTCATTAATCGTTTAAGTTGTTTTGACTTCACTTATTT
page-top