Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig45
Contig Information
Length 366 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16h08    rwhem16h08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit conserved hypothetical protein [Schizosaccharomyces japonicus yFS275] >gi|212003193|gb|EEB08853.1| conserved hypothetical protein [Schizosaccharomyces japonicus yFS275]
Score 78
Evalue 2.67611
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig45
TGCATATTCATGTTCTAGCTCTGTTTGGATAGGTAACAATATTTTTTTGGATCCTAAAATATTTATGCACAGCACTTAACCTGCAGCTGCTGATTAATGT
TGTAGTCGTATGTGCTGCTTTCCAGCTCTGTTGTTTGGATAGGTATTTGGTTATCGTTTGGGTTTATTTATTATATGTGATACTAATATTTGCCAATGAT
GATGTATCTTTTGCCAACCAATCTCTAGTCTTCTTCTTGAGGACTGTAAATGCTGGTTTGGTTTTCTGTCCTCACCTAAAAAGCACGGACACGCCAGGAA
TCGCCGAACTGCCGTCCTGATACGGCGGGATACGGGGATACCGGCGGGATATGGCGGGATACGCGA
page-top