Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig44
Contig Information
Length 748 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem17d14    rwhem17d14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ubiquitin-protein ligase [Zea mays]
Score 456
Evalue 1.15812e-43
Total Hit Count 275
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig44
TCCTTTCGGCTGAACGAGCGCTGGACGATCCTCCAAAGGGGGTTTGCAGCCTTTGAGGGCATGGATGATGACACGGGAGCGCTCGGGATCGCGAGCAGCA
TGCCCGAGCTCCGAGACCTCCAGCTGATCGGCAACAACCTGACCAACACCGGACTGGCCGCGATCCTCGACCACTGCCCCCGCCTCGAGTCCCTCGACGT
GCGCCGCTGCTGCAACCTCCAGATGGATGATGCCTTGAGATCCAAGTGCGCCAGGATCGGGAACCTCAGGCTTCCCCGGGACCCCATCAACGACTTCAAG
TACCGGGCTTACCTCGCTATCAGTGATGACTACCCCGGCGGTTCCGACATCGAGGTCGACATGTACGATGATCTGCTGGACGTGGTCACCGACGAGGAGG
ATGCCGAGTTCGATGACATGGCTGATTATATCGACGGTGTGGGCTCGGACGCTGACATGTATGATGACGTGTTCGACGATGTCTGAAGGAGCTGTGACCA
GGACCCGGGTTCTCACGTGCAAGGACGGGAACTTGGTGCTGAAGCAATGTGGTCTCTACTGTGTTGCGATTCTTGAAGGACCGGGTTCACGCACTTTGTT
ATCGGAGATTGATTCTCGTATTATGTTTGTGCCTCCTGTTTGTTAACTAGTATACTCTCTTGCTGTGTGCCTCCTGTTTGTTAACTAGTATACTCTCTTG
CTGTGAAACGGGGTTAGTTTCGTCTCTGCGGTTGTAATTTATGCTGCA
page-top