Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig43
Contig Information
Length 706 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16n23    rwhem16n23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_24535 [Oryza sativa Indica Group]
Score 378
Evalue 1.13517e-34
Total Hit Count 32
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig43
TTCAAGCATACGCTGCGCCGCCAAGTGCGTGGGTTCTTCCATACAATTCATTCCCGCTCCATTTCGGGGAATCAGCGGAAGCCAGAATTGCCCGTTTGCA
CATGTGGTGGCCATACTATGGGTTTCCTATGGTCCATCCAAGTGGACCGAGTGCAGTGGCACACAACGGAAAAGTTACTGATGAGAGCGAAGCTGCGAAG
AGCCCTCCAGTTGAATCAAGCTCGGACTTCGTTGACAATACTCAGGCAACAGCCAGCAAGCAGTGGAAAGTGCTTGAGTCGCTTGGAACAGCGCAGGCCC
CTCCGTCGGCTTCTAATTTTCAGCTTAAACCAAGCACGAACTCGGCCTTCGTGAGAGTGAAGCCGATCATCAGCAGTGGAGATGAGCCGGTGAGGGGGTT
CACGCCGTACAAAAGATGTAGAGTCGAATGACAAAAGCGGGGATCTTCTTCCCCGTTTCTAATTTAACTATGAACCCTAGGAGGAGCCTGTTCCACATAT
TCCTTTGCTCCAGTGTATTCTTAGGTTTTACTTGCACATAGAGATTGGCGGCGGTCTGGTCCGGGAAATGCGCGTTGTTTCCTGCTTGCGCCTTGTAATG
AGCAGGGCACAGGTGGTTGCTGTAAGTGCGGTAGGATAAAAGCAGGAGGTTTTGTAGGGATGCCAATTCTCTGTCTCTCATGTTGTTGATGTAAAAGCAA
AGAATT
page-top