Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig41
Contig Information
Length 1119 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem17c18    rwhem17c18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit transglutaminase [Zea mays]
Score 197
Evalue 9.97698e-34
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig41
GGTTGCGGAGCTAGATGGTCTACGGAAAGAGCATCACAGTCTAAGATCTGCCTTTGAGTATGAAAAAAACACAAACATCAAGCAAGTTGAGCAGATGCGG
ACCATGGAAATGAACTTGATAACCATGACTAAAGAGGCGGACAAGTTACGAGCTGATTTGGCAAATGCTGCAAACCGAGCACATGCAGCACAGGTTACAC
CTCCACAGCCTGGGACAGGACAAGCTGCAGCGGCTTCAGCAGCCACAAATCCATATGCAAGTGCATATACCAGTCACCCCTCCGCATATCAGCAAGGAAC
TTCCCAAGCCGCGGCATACCAGCAGGGAACTGCCCAAGCCGCAGCATACCAGCAAGGAAACCCCCAATCCGCGGCATACCAGCAAGGAGCCCCCCCAATC
CGCGGCATACCAGCAAGGAGCCCCACAATCCGCAGCATACCAGCAAGGAGCCCCCCAATCCGCAGCATACCAGCAAGGAGCCCCCCAAGCCGCGGCATAC
CAGCAAGGAGCCCCCCAAGCCGGAGCATATCAGCAAGGAGCCCCCCAAGCTGGAGCGTATCAGCAAGGAGCCCCCCAAGCTGGAGCGTATCAACAAGGGA
CATATGGTTACCCAACAGCCTATGATTCTGCCACCGCTTATCAGCTGCATGCTAATGCATATGCTAGCTATTCTGGCTATCCAGTTGCAGGCTATGCACA
ACCCAGCTATCCTGGCACGTACGCTGCACCTCAGCAGCACCCAGTAGCCAGTGGCGTGGCTACTGATACCACAAGCGCGTACGGTGCCGCTGGCAGCACG
GGATATCCTGCCGCACCAGTTCAGGCAAGCAGCGGGACTAATGCGGGGCAAGCGGCGCCACCAGCTCCTTATCCTGCAACATATGACCCAACCAAAGCAG
CCCAGAGGTGAAATCCGGGGTTGTAACCTGAAGATGGCCTGTGTGCCTGCAAATTTTATCAGAAATTTCTCAGGCCTCTTATTTCCTTCATGTACATTCA
TTCACTCCCTGTAGCTTTATGCACACCATGGAGCTGCTGAGAGTCGCAGTTTATGGTCTGAGTCTTGAATTGATTTGTATCTCTTGTTTTGCTGGATGGT
TGAATTGATAGGTGCAGCT
page-top