Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig40
Contig Information
Length 641 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem17a02    rwhem17a02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative transcriptional regulator [Burkholderia pseudomallei 305] >gi|134246688|gb|EBA46776.1| putative transcriptional regulator [Burkholderia pseudomallei 305]
Score 93
Evalue 0.104279
Total Hit Count 66
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig40
CCACCATTTATCTTTCAATCGCCGCTCCTCCTTCAACAGCACCATGCCTAATAGGCTCGCCTCTCTCGCGGCCCGGCCGCCGGAGCTCGCCATGCTCTTC
TGCGAGAGGGGGAGATGACAGTGCTGCAAGGCGACAGCCACCATGGTTGCGGGACGATGGCAGTTCGCGGCGGCGGCGCTGCGGGATGTTGCAAGGCGGC
GACGGGCCACGGCGAGAGGCGTGCTATGACAGCGTCGACAACCACGGAGGTGTCGCGAGGCTGCGGTGATGCTTCAATTTCCGTGGCTACGCTCGGTGCT
GAGCTGCGCTCCAAGGGCGGCCGCCGGTGCTATGAGTCTATGACGACCCGCCGGTGGCTGCGCTGCTATGAGGCCGGCCCGGTGATTTCCCAACTCTATT
TTCTGGATTGCTCCGATCTGCACCGACAAGCGGTCCTGCCGAGGTCGTCCGATGTACGGCTAATGTGAGGCCACCGGAGCTGCGGGACGGGCACGGGCCG
CACGGCTGCTGCCGGGACGACAACAAACGGGGCAGCGACGCCCGGGCCTCGGCCCTTTTTTTGGTTCCTTCCTCGCTGGTACCAGGCTACCGGCTGTGTC
TCAGTGTCTCTCTTCTCCTGAGCTGGGGCATGCACGCATAT
page-top