Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig37
Contig Information
Length 302 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16o08    rwhem16o08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Pc06g00350 [Penicillium chrysogenum Wisconsin 54-1255]
Score 78
Evalue 2.70033
Total Hit Count 22
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig37
CGCAGCTGGCCGGCGCCGGCCCCTCTCGGACGATGAGCGGAGGAAGAAGACGGGACGGAGGGGTCTGTTTGAGACAATTTTGAGATGACGAGGTTTTGTT
TGCAAATTTACCAATGAACTGGGCGTGCGACATTAATTTCGGGACGGAGGGAGTACTAAATTTGATCATACACATAGCAGCTCTCTTATCATTTAGGTTA
ATTAAAGATGAAATGCATATTCATGCCTACATATGTATCTACTACTACGATCTCAATATGATGCAAAATAATCATGCAAACACTTATTAACTAAAAAAAA
AA
page-top