Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig36
Contig Information
Length 417 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16o10    whem16o21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_33234 [Oryza sativa Indica Group]
Score 120
Evalue 3.60316e-05
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig36
CTTGCTTTAGAGGAAGGTAGCTGGAGTAGCCTGCATCTTTCAGCTGCGCCTGGTCAAACATGGCTTCCATGGGGTTCAGCTATGCGCAGATACATGTGCG
GCAGGAGAAGGTCCGGCAGAGGATCAATCAACAAGAAGCCGCCAAGAAGACGACCGTGAAGAGTATCGGTGAAGGAGATAAGATCAAGAAGAAAAACTGC
GACTCATGGACCGCCGCCGGCAGGGTGCATCCGTGCGCGTCTTCCACGGCCGCGGCGGCGGCTACGGCTAGGCCGGTGCCAGAGAGGTGAGGCTGGCTGG
CTGTGCGTCTTCTCTTCTCTGTAGGCCACAAGAGGCTTGATTTGAGAGTTTAGTTTGTGTCTCTGATGAGTAGTTTTAGCTTGTCTCAAGATTTCCTCCA
GGGGGGGCCCGGTACCC
page-top