Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig35
Contig Information
Length 905 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16o03    rwhem16o03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein CNM00670 [Cryptococcus neoformans var. neoformans JEC21] >gi|57230621|gb|AAW46931.1| conserved hypothetical protein [Cryptococcus neoformans var. neoformans JEC21]
Score 88
Evalue 0.769503
Total Hit Count 45
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig35
GCTCGGTCCCCACCACTTCCATTTCGAGCTAAGCCCCACAGGCCAAGAGATGGCGGCCGTGCTTCGTTCCGCGACTAGAAGGTTGGCCGGCCATCTGCCG
GCGCTTGAGAGGGGCCACATCCAGCTCCCAGGGGCTTCCTTCGATCCACTCAAGGGCCACTGCTCAGCCCACTCTGGTTTCACTTCCCACTGCTCACCCC
AGACGGCTGCACTACATGGCGGTGCTTTCAGGCCAGCTCGCATCGCACCAAGCAGCAACCCCGTGGGATCTATGTGCACACGCATGTTCTCTACGCCAGC
TGGTGGCTCTGCCCGGCCACCGCAGGACAAGTTTTGGTTTGAGGTGGTGGTGCATAGGACACCGTGCCCAGAAAATCCCCGTCCTTGCCTTTACCGTAAA
AGGTTCTACAATGTTGACAAAGATAAGGCCGAATTAATCTTCAGACACTTTTTGAGCAGGGTAAATCAAGATTCAAAGGCCGCCGCTAGTGACTCGCTAA
AGTCGCGTTTCACCAAGCTTAAGTTTATCGTGACAGATAAGCTTTATCTTGTTTTGGTTGGAGCCGCTTTAAAATCTGGAAAGATGCAGCTTCTTATCGT
CTGTGCTTTGTTCTACGTACTCTTTCTGAGGGCACCATCTTTTATGCGAAGAATGGCGAGGGTTGCTGCACCACCTGCCAAAGGGAATGAGTCAGAGTGA
TGGTTATTTTTGTTGGTGCTCTGTATTGGTGGAACTTTATTTGTGAACCTTCTTCTGTACCTTAGGTGCTACTTGGTCTGCATGTGTGAGACTTCATTTG
TGAACCTTCTCTGTACCTTAGTTGCTACTTGGTCTGCATGTGGACTTTATTTGTGAACCTTCTCTGTACCCCTTAGTCGCTANCTTGGTTCTGCCATGTG
TGAGA
page-top