Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig32
Contig Information
Length 463 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem17b08    rwhem17b08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_035508 [Oryza sativa (japonica cultivar-group)]
Score 344
Evalue 3.80687e-31
Total Hit Count 279
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig32
CAACTTTGGAACACTTGCATTTTGCCGCCGGTACTTGGACCGCATCGGCGAGACCAAGTATCTCATGGCACTGAAAAATCTATGTGATGTTGGCATTGTT
CAGCCGTACCCGCCATTGTGCGATGTGAGGGGAAGCTATGTGTCCCAGTTTGAGCACACCATTTTGCTCCGGCCAACCTGTAAAGAAGTCATATCCAGAG
GCGACGACTACTGATTGGGGCTGCGGCTCCTGTCTGTACCTGTCGCCTGCAGCGATTAGTGTTTTACCGTCTTGGGTGACCTGTGTTCGTTATTATGGAT
CAAATGGCACATCAGAATCAGACAAATAATGCGGTTACATTGCACCCTTTTGTTTTCTGAGTTTAGAATTTGTGGAAACTGGTTTGTAAGAATTGCTACC
GTGTTGTATTACTTGATCCCTCTATAAAGAGTACTTCCTGGAGATTTTTTATCANAAAAAAAA
page-top