Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig31
Contig Information
Length 1198 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16k01    rwhem16k01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38149 [Oryza sativa Indica Group]
Score 1578
Evalue 1.99609e-173
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig31
TGGTATCAGTTACTATCACGAGTGATTTTTGACAAGGGAGCCCTTCTATTCACGACTGTTGGAAATGACTTGACATTTCAACCAAACCCTAACTCTGTGT
ATCAGACTGAACACCTCTCATATTTCAAATTTGTTGGACGAGTGGTTGGAAAAGCGCTCTTTGATGCCCAACTTTTGGATGCCCATTTCACTAGATCTTT
CTACAAGCACATACTTGGTGCCAAGGTTACTTACCATGATATTGAAGCCATTGATCCTGCTTACTACAGAAACCTTAAGTGGATGCTTGAGAACGACATA
AGTGATGGCCTGGACCTCACATTTAGCATGGATGCAGATGAAGAGAAGCTGATATTATATGAGAAAGCTGAGGTAACTGATTGTGAGTTGATTCCTGGAG
GGCGTAACATTAGGGTCACTGAGGAGAACAAGCATGAATATGTGGATAGGGTAGCAGAGCATCGTTTAACCACTGCAATTAGGCCTCAGATTAATGCTTT
CATGGAAGGATTTAATGAACTCATTCCTCGCGAGCTAATATCCATTTTTAACGACAAAGAGTTTGAACTGCTAATCAGTGGACTCCCTGATATTGACTTG
GACGACCTAAAGGCAAATACCGAGTATTCTGGCTACAGCATAGCTTCTCCAGTTATTCAATGGTTCTGGGAAATTGTACAAGGTTTCAGCAAGGAGGACA
AAGCTCGATTTCTCCAGTTCGTTACTGGCACTTCAAAGGTACCTTTGGAGGGTTTCAGTGCGCTCCAAGGAATATCTGGGCCACAAAGGTTCCAGATACA
CAAGGCATACGGCAGCACCAACCATCTGCCCTCAGCTCATACTTGCTTTAACCAACTGGACTTGCCTGAATACACATCCAAAGACCAGCTGCAGGAGAGG
TTGCTATTGGCTATTCATGAGGCAAATGAAGGGTTTGGATTTGGTTAATCAGTCATTCCCGCACTTGTGCATTCGCTGCTGGGTATTTGTACAGATAGTA
CGGGAGTTGCAATAGGCAAGTGGGAATGTGTGCGTGCTTGTTCCACAGTCTGCTAGATCCCACTAGTTGGCAACATGAAGCATCAGCCTTAGGCACTACC
AGGAGGTTCTCGATATTTGTTGGGACATGGCCGAGATCTACCAGAATCATTGCATTGCAAACAAGTTACTGCAAAGAATGTGCAGTGAGTGGGAGTTA
page-top