Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig30
Contig Information
Length 397 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem17b02    rwhem17b02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit leucine zipper protein zip1 [Triticum aestivum]
Score 357
Evalue 6.61493e-59
Total Hit Count 188
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig30
CGCAGTTCCTCAATGACTGGAAGGCCAAGCTCTGGTCACGCTTCTTCTGCCTCTCGAGTGTATATAACCATGTACCTGAATGACTGCCAACGTAGTGCCT
TCTACGAAGGAATTGGTCTCAACACCAAAGAATTCGACATGCATGTCATCTATGAGACCAACCGCACGACGGCGAGGATCTTCCCTGCTGTACCGGATGT
TGAGAACCCTGAATTCAAGAGGAAGCTAGACAGGATGGTAGATATCAACCTGAAGATCATTTGGTATAGGAGAGTCCAACGACATGCCCCTGGTGAAGAA
CCTAAAGAGGGTTCCTCTTATTGCCCAACTAGTGTCTGAGATCATCGCTGCGTACCTCATGCCCTCAATCGAGTCTGGCTCCGTTGATTTTGCCGAG
page-top