Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig29
Contig Information
Length 1132 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16k11    rwhem16k11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0861100 [Oryza sativa (japonica cultivar-group)] >gi|108712232|gb|ABG00027.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113550449|dbj|BAF13892.1| Os03g0861100 [Oryza sativa (japonica cultivar-group)] >gi|215713592|dbj|BAG94729.1| unnamed protein product [Oryza sativa Japonica Group]
Score 748
Evalue 3.20693e-77
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig29
ATGCAGCTCGACGAGACCAAGTCGGCAGCCCTACCAGAGCTGAAAGTCAAATCCCCCCGAACCCCTGCCGCTGTCGTTGTGAAGAACAAGGCGGCGGCTA
AAGTAGCAAAAGAGGCGCCACGTGGTGGACCTAAAGCACATGCTACTTCAGAAAGTAGAGATGGAAAGAAATCTTCCAACGGTAAAGTTTCAAGGGTAAT
CAGCAGTGATGACAATGTGGTGGTTGAGAAGACCGTCGTGATGCTTGAAAACGAAGTGGTCTCTACGCCTCCTGTTGTTCTACCTCCTGGAAGAAGTGCA
GAGAGCGAAACTCGCAGCGATGACCGAATGGACTATCCCAGTCTGGAGCAGGAGTATGTTGCCATCAGGGCTCCACCTTCTCCTGTTGATCTTCCTGAAG
ATGCAAATCCTACCATCCATGCATCTGACAACCAGTTGAATTCCTATGAGGTGGATGTGCCTGAGTACAAGAAGGATGAGCTTGAGAAACCAGCCCCGCT
GGCTCCAATGGAGGAGAAGCCTTATGAGGCCCCTTTTGCCAGGGTAACATCATTGGAGGATGCTTCAAGCAAGACTCCTGCTTACAACCAGCACCCGTTA
CCTGCGCAGGAACCCGAGACACTTGCGCGTGCAGCGAGCGTGAGGGCACGCGTACCTGAGCCTGCTGCATATGCAGTCTCAGCCGAGGAGACACATGGAG
AAAATGGCAAGCCTCGAAGCAAAGAACCGAAAGGCTTCAGGAAACTGCTGAAATTCGGCAAGAAGAGCCACACTTCAACGATGGATTCTGATGCATCGTC
AGTCGACGAAGCCCCTGCAGGAGATGGTTCGATGCTGAAAAACCTCATTTCACAAGACGACTCTGCAGGCTCTTCTTACAAAGCTTCTCGGTCCTTCTCC
CTGCTGGCGCCATTCCGCAAGAACAAGGTGGTCGTGCTGTGAGGATTTTCTTGTACTATTTTTGTTGTTGTTGATGAGGCCGGCCAACAGCTTGATTGGG
TATCGATTGAGATTATTAGTTTGTTGATTTCTTCTAGTAAATACATACATACGTGCATACTATTTCGTATATATATACTTGCACTGTACGCTTGTGTTGT
GTTGTTTGTAAGCAGTACTGTATGTGTAATCT
page-top