Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig28
Contig Information
Length 1032 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16l10    rwhem16l10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glucose-6-phosphate dehydrogenase [Triticum aestivum]
Score 1565
Evalue 5.09772e-172
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig28
AGAGTTGGTCCAAAACTTGCTTGTGCTTCGTTTTGCGAACCGTTTGTTCTTACCACTTTGGAACCGTGACAATGTTGATAATATACAGATTGTATTCAGG
GAGGACTTCGGAACTGATGGACGTGGAGGATATTTTGATCAATATGGAATCATCCGTGATATCATTCAGAACCATTTGTTGCAGGTTTTCTGTTTGGTTG
CAATGGAAAAGCCTGTATCTCTTAAGCCTGAGCACATCAGAGATGAGAAAGTCAAGGTTCTGCAATCCGTGAACCCGATAAAGGACGAAGAGGTAGTCCT
TGGACAATATCAGGGCTACAAGGATGACCCTACAGTGCCAGATGACTCTAATACCCCAACGTTTGCATCTATTGTACTTAGGGTACACAATGAAAGATGG
GAAGGTGTTCCTTTCATTCTTAAAGCTGGTAAAGCATTAAACTCAAGAAAAGCAGAAATTCGTGTGCAGTTCAAGGATGTTCCCGGTGACATTTTTAAAT
GTAAGAAGCAGGGAAGAAATGAGTTTGTCATACGCCTCCAGCCATCAGAAGCCATGTACATGAAACTAACTGTGAAGAAACCTGGATTGGAAATGGCTAC
TGAACAGAGTGAACTTGATCTGTCATATGGGATGCGTTACCAAGATGTCAAAATTCCAGAGGCATACGAGCGCCTCATTTTGGATACAATAAGAGGAGAC
CAGCAACACTTTGTGCGCCGAGATGAGCTGAAGGCTGCCTGGCAGATCTTCACTCCCTTGTTGCACGACATCGACGCTGGCAAGCTGAAGGCTGTTTCAT
ACAAGCCTGGCAGCCGAGGCCCCAAGGAAGCTGATGAACTGAGTGAGAAGGTTGGGTACATGCAGACCCACGGTTACATCTGGATACCACCCACCCTTGC
ATAGAGTGCCTCCCTCGATCCTTGTAGGTTTGTTTAGCTAGGAAGAGTGAAAGTATCACGGATAAAAATCTTACGAATTTTAGCTGTACTGCGGTTTACC
TGGCGTTGTAATAACGGATCTGTTCGACGGAG
page-top