Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig26
Contig Information
Length 804 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16k18    rwhem16k18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit H0716A07.7 [Oryza sativa (indica cultivar-group)]
Score 949
Evalue 8.99506e-101
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig26
ACATGGCTCAGCTGTGGAAGCTTCCGATTATTTTTGTTGTGGAGAACAACCTATGGGCAATCGGGATGTCTCACCTTAGGTCTACTTCAGATCCCGAGAT
CTGGAAGAAGGGCCCAGCATTCGGAATGCCTGGGGTACACGTCGATGGGATGGATGTCCTGAAGGTCAGGGAGGTGGCTAAGGAGGCAATTGACAGGGCA
AGGAGAGGTGAAGGACCAACTCTAGTGGAATGTGAAACTTACCGGTTCAGAGGCCACTCTCTTGCTGATCCAGATGAACTCAGGAGGCCCGATGAGAAAT
CTCACTACGCCGCAAGGGACCCCATCACCTCCCTGAAGAAGTACATCATCGAGCAGAACCTCGCGTCCGAAGCCGAGCTGAAGAACATCGAGAAGAAGAT
TGACGACGTCGTCGAAGAGGCTGTGGAGTTTGCCGACGCGAGCCCGCTGCCCCCACGGAGCCAGCTGCTGGAGAACGTGTTTGCCGATCCCAAGGGCTTC
GGCATCGGCCCCGACGGCAAGTACAGGTGCGAGGACCCCAAGTTCACCCAAGGCACGGCGCAAGTCTAAGGGCCGCTGCTGCAGAAGCAGCTTGTTTACG
CCTCTTTTCTCATGTACTACCTCTCTAGCTACCTGCCCCTAGTTTTGTCGATCCCGCCGTCGATTTCTTGTGTTGTTAGAGGTCACATATCACTGTAATT
CATTGCTCGCTGTGCCACCGTGCGGCGTCTGATGCCCCCAGTTTTTTTTACCCAAGAAATGTTCCCCAGTCCAGTTGTTGTTCTACAGTAACTCTACATC
TGTC
page-top