Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig25
Contig Information
Length 862 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16l05    rwhem16l05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_14032 [Oryza sativa Indica Group]
Score 933
Evalue 7.40843e-99
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig25
CGCCCACCTTCTCCGGCTCCGGCGCCGGCGAACCCACCGCGGATCGAGCGATTCCCCCGATCAGGAGAGGCGAGCCGGGAGGAAGAGCACCTACGCGGGA
GGAGAGGAGATGGGGCTCACGTTCACCAAGCTGTTCAGCCGCCTGTTCGCCAAGAAGGAGATGCGGATCCTGATGGTGGGTCTCGACGCCGCCGGAAAGA
CCACCATCCTCTACAAGCTCAAGCTCGGCGAGATCGTCACCACCATCCCCACCATCGGGTTCAATGTTGAAACTGTGGAGTACAAGAACATCAGCTTCAC
TGTCTGGGATGTCGGGGGTCAGGACAAGATCAGGCCACTGTGGAGGCATTACTTCCAGAACACACAGGGTCTCATCTTTGTTGTGGACAGCAACGATAGG
GACCGTGTTGTTGAAGCAAGGGATGAGCTCCACAGGATGCTGAATGAGGATGAGTTACGTGATGCTGTGCTGCTTGTGTTTGCTAACAAGCAAGATCTTC
CAAATGCCATGAATGCTGCTGAGATCACTGATAAGCTTGGCCTGCACTCCCTTCGCCAGCGACACTGGTACATCCAGAGCACTTGTGCTACAACAGGGGA
GGGACTGTATGAAGGCCTGGACTGGCTGTCCAGCAACATTGCCAGCAAGCCCTAAATTTTCGTCAAGATTTTGAAGGAGCTAGGAGCGCTTTGGATGGAC
GATTGAATCACCGGGTACCTAGGGATTGTGTTGGGATGGGATGGTGCTATGCTATTCCCGTATGTACTGTGTATTTTCCTGAGATCAACAGTTACTGAGC
CAGCTCCGGCTGTGGTTTCACTGTCATACTATTGTTTTATTGTATTCGAGCCCTAAGATGTT
page-top