Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig24
Contig Information
Length 428 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16p07    rwhem16p07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0420700 [Oryza sativa (japonica cultivar-group)] >gi|50725970|dbj|BAD33497.1| copper chaperone COX17-1-like protein [Oryza sativa Japonica Group] >gi|113631431|dbj|BAF25112.1| Os09g0420700 [Oryza sativa (japonica cultivar-group)] >gi|218202159|gb|EEC84586.1| hypothetical protein OsI_31395 [Oryza sativa Indica Group]
Score 319
Evalue 3.07691e-28
Total Hit Count 168
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig24
GTGCGATTTTGGATCCGCGACCTCCAGCTCCCGCTGCCCTCTCCCGCCGAGTCCCGGAGCTCCGTTCGTCGATATGGGGAACAGTACATCTGCTACAACC
GTCACCCCAGTTGCAGAAGAAAAAACAGGACAAACTCCAACGGCTGACACGAAGCCAAAGAAGAAGATATGCTGCGCCTGCCCTGACACAAAGAGGCTGA
GGGACGAGTGCATCGTGGAGCATGGCGAGGACGCGTGCGGGAAATGGATCGAAGCCCATCGCCTATGCTTGAGAGCCGAAGGGTTCAACGTCTGATACGT
TCATAGCGGGCTCTAAACTTGCTCCCGTCTTGGTTCTAAACGACGAACAATGTCGGTTAACAGTTTGATCGCTGGGCATTCCAGTTTGCGGGGAGGGATG
TTCTCCCCCCTAATAGGCATTCAGCGCC
page-top