Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig22
Contig Information
Length 503 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16l19    rwhem16l19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit YALI0F16049p [Yarrowia lipolytica] >gi|49651351|emb|CAG78290.1| YALI0F16049p [Yarrowia lipolytica]
Score 76
Evalue 4.97081
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig22
TTTTCAAATAGCTCTGAATATGAATTGGGACCTTGCGCTGTTTGGGGTGGAGCTGTTGGGAGTGAGAGGCGGATAACAATAGGGCGAAGAAGCATGCCAT
CGAGGAGTGCAAGCAGCAGTGCTCCTTCGCAATGGGGTGTGGCTATAGGGGAGGGGAGGCGGCCAACGACGGGGAGAAGGAGCAGGTCGTCGAGGAGTGC
AAGCAGCAGGATTAATTTAGGCCCATACAGTTTCCGTGGACTGGAAGTCTGAAACTGAAGATAGGGCATATTGTTTTGGTTCTGAGTGGTTGGAGATATT
GCGGATTGATGTCCCTAGAGCAGTCGGACCCTTCCAAGATAGGTGCTAAAATCCTAGGTGTCAAGGGCATTGTGGTGGCGCGATCCATGTCTACTGCAAT
CGCTCGGCATGGCGTCCATGGCCCCTTTTGCTGCATTTTTTGTTTTTCGGCAAATATGTTCTTGCTTGACCCCCTGGTGAATATGTTCATGATTCATAAT
CAT
page-top