Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig21
Contig Information
Length 905 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16p15    rwhem16p15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_14693 [Oryza sativa Indica Group]
Score 893
Evalue 3.47637e-94
Total Hit Count 429
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig21
ACTTTTCATTCAGTATGAACAGGCCAAGTTCTTCATGATAAAGTCATATAGTGAAGATGATATTCATAAAGGTATCAAATACAATGTTTGGGCAAGTACA
CCAAATGGGAACAGTAAGCTGGATACCGCTTTCCATGATGCCCAGATTTTAATGAAGGAAAAGGGTACAAAATGTCCTGTCTTCCTCTTGTTTTCGGTTA
ATACCAGTGGGCAGTTTGTAGGATTGGCTGAGATGTTAGGTCCTGTTGATTTCAAGAAGACCATGGACTTCTGGCAACAAAATAAATGGAATGGCTTTTT
CCCTGTTGTCTGGCACATTGTAAAGGACATTCCGAATAGGCTCTTCAAACATATCACTCTAGAAAATAATGACAACAGACCTGTTACATTCAGCAGGGAT
ACTCAAGAGATTGGCCTTCCCCAGGGTCTGGAAGTGTTGAAAATTTTCAAGGCTTATCGCCATGGAACATCAATTCTGGATGACTTTGACTTCTATGAAG
AAAAGGAAAACACTCGCTGTGCACGCAAGGGAATAAATGCAGACTCGTTACATGAAGCCAGACTATCATACTTTGGAACAGATGACTTGAAATCAATGGG
AGACATCGAGGCGAACATGGAGAGCCTGAACCTCCACGAGCCTTGGGACTAATCCGGATGGTTCTTCACCATGTCGCAAAAAAATTAACGAGCCATTGAC
GCGGTCGAACGAGAAACGTTTGATCCGGCGAGTGGGCGCTACTACACAAGTTAACCTGAAATATGCTATAGAATGTTTGTACTTTGTATGGACCATATAT
AGTTTGCCGGTAAACACATACCATATATATCTAGTTTCCGTCGTCGGGGTAAGATAGTTTTACAAATCGGTACAACAATCTTATGGTGACTGCCATGTGT
GTCCG
page-top