Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig20
Contig Information
Length 1213 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16p13    rwhem16p13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative RNA polymerase A(I) large subunit [Oryza sativa Japonica Group]
Score 876
Evalue 5.10872e-92
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig20
AGTGTGGCTGCCGCAAGCTTAAAAAGAAGTGTCGCTGCCATTATAACATCAAGGAGGAGGAACTAATGAAGTTACTGAAAGTCAAGTACATGGCTAGCCT
TGTAGATCCTGGTGAAGCTGTTGGTGTGATCCTTGCTCAGTCCTTAGGAGAACCTTCAACGCAGATGACGCTCAACACTTTCCATCTTGCTGGAAGAGGG
GACATGAATGTCACACTTGGGATGCCTCGCATACAGGAAATCCTAATGAAAGCATCAGCTAATATTGGCACACCTTATATGAAGTGCCCTGTGCATAAAG
GCAAGAAGAGGAAGGATGCTGCACGTCTGGCTGAAAAACTAAGGGGTGTTACGTTGGCTGATGTTGTGGAAGGAATTGAAGTATGCACAGTTCCTTTTCA
CAATAGTAATGGGCATATTTCGAGTCTCTATAAGTTGCATCTAAAACTATTCTCACCAGACTGTTACCCTCCTGAGTCGGAACTTACAGTAGATGAGTGT
CAAGCATCCTTGAGAACTGTGTTTGTTGATGCTATGGAATATGCAATCGAAAAACACCTAAATTTGCTACACAAAGTTAGTGGAATCCAGGAAACAAGGG
TAAAGGACACTGAGAGTTTACCATCAGAAGGTCCTGAAGAATCCGAGGGCAGACCTACTGACGGTGACGAGTCTGATGCGAGTGATGGTGACGATGAAAA
TGAGGACGACTTGGGAGCTGATGCAGAAAAGAGGAAACGACAAGAGAATGATGAGATGGAGTATGAGGATGATATTGAAAATGAAGATGGCATGAACAGT
GACCCTGATGAAGAGACAAAACATGAACTTGATAATGAGGATGATCCAGCTGAGTCTGGTGGAGAATCAGAAGAGAATAACGAAGGACATTTGTCAGATT
CCAGTAACAAGACTGCAAAATTAGAAGGCAGGCTTGCAGCTAGTAAACTCAAGGAGAGTAATGAAACGGTGGAAAACTTGGAGGAGCAGAAGCAGGCACA
AATAACCCGGAAACGCAGCAAAAAGTTAAAGCTGACTGTTCATGTTGAAAGCGCAGATTTGAATTTTGAGGTTCACTACATCTTGCACAAGGAACCACAT
ATTTTACTATCCCAGATTGCCCAGAAGACGTTGAGGTCCCTATTTGTCAGTGGATCCCATAACAAAAACATAGGTCTATGTAATGTTATTTGGCCAGAGA
AGGAAAAGAAAGG
page-top