Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig16
Contig Information
Length 1074 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16m02    rwhem16m02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L16 [Triticum aestivum] >gi|45477199|sp|Q95H50|RK16_WHEAT RecName: Full=50S ribosomal protein L16, chloroplastic >gi|13928242|dbj|BAB47071.1| ribosomal protein L16 [Triticum aestivum]
Score 688
Evalue 2.69004e-70
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig16
GTGTATCTATCCGTACCGTAATATTTTGGAATATTATGAATTAGATAAATTTACATGCTTTCTCATTCCATTCGCGAGGAGCTGGATGAGAAGAAACTCT
CATGTCCAGTTTTGCAGTAGAGATGGAACTAAGAAAGAGAACCATCGACTATAACCCCAAAAGAACCAGATTTCGCAAACAACATAGAGGAAGAATGAAA
GGAAAATCCTGCCGAGGCAATCGTATTTGTTTTGGTAGATATGCTCTTCAAGCACTTGAACCCGCTTGGATCACGGCGAGACAGATAGAAGCAGGACGAA
GAGCAATAACACGATATGCACGTCGTGGTGGAAAAATATGGGTACGTATATTTCCCGACAAACCGGTTACACTAAGACCCACAGAAACACGTATGGGCTC
GGGAAAGGGGTCCCCCGAATATTGGGTATCCGTTGTTAAACCTGGTCGTATACTTTATGAAATGGGGGGAGTATCTGAAACTGTAGCTAGAGCAGCTATC
TCCATAGCTGCCAGTAAAATGCCCATACGAAGTCAATTTATTCGATTANAGATATAGAACCCTAAAAGGGGTATGGAAGATAAAAAAAAAATGCCCGGTT
TTTCTTTCTGGAAAGACAATATTTCTTTCATCCTTTTGCATTGAAATAACAAATTGAAATCAAAATAATATGATTCAACCTCAGACCCTTTTAAATGTAG
CAGATAATAGTGGAGCTCGAAAATTGATGTGTATTCGAGTCATAGGAGCTGCTGGTAATCAGCGATATGCTCGTATTGGTGATGTTATTGTTGCTGTAAT
CAAAGACGCATTGCCCCAAATGCCTCTAGAAAGATCCGAAGTAATTCGAGCTGTAATTGTACGTACATGTAAAGAGTTCAAATGCGAAGACGGTATAATA
ATCCGCTATGATGACAATGCTGCGGTTATAATTGATCAAAAAGGCAATCCAAAAGGAACTCGAGTTTTTGGCGCGATTGCCGAGGAATTGAGAGGATTGA
ATTTTACCAAAATAGTTTCATTAGCTCCTGAAGTATTATAAATACTAGTAGGCGAAATTGAGATCAAAGAATTA
page-top