Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig14
Contig Information
Length 734 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16o14    rwhem16o14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_16043 [Oryza sativa Indica Group]
Score 686
Evalue 2.4025e-70
Total Hit Count 387
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig14
AAGTATGTTGGGTCCGGATGTTGATGCTATGAAAGCTGTAGCTGATGCCTACTCTAAAAGATCTCTCAAGTACTTTGAAACTGCCCTCCGTGATTTCAAA
GCCCAGCTTGAGGAGGACCCTATTGTTCACAGGCATCTTTCCTCTTTGTATGATACCCTCCTGGAGCAGAATCTGTGCAGGTTGATTGAGCCCTACTCGA
GAGTGGAGATTGGGCATGTTGCACAGATGATTGAATTGGCGGTTGATGATGTTGAGAAGAAGCTGTCGCAGATGATTCTAGACAAGAAATTTGCTGGTAC
TCTGGATCAAGGTGCTGGTTGCCTCATTATCTTTGAGGATCAGAAGACTGAGGCCATCTTCCCTGCTACACTAGAAACCATTTCAAATGTCGGAAAGGTC
GTGGACAGTCTTTACATGAGGTCGGCTAAGATCATGGCTTGAAGGTTGCTAAGCATGTGATAGGCTGTTTGGTATGGGTTCAGCCTTTTCAGTTCCTTTG
CTGTCTTTAAGACATGTAATCCTGCATATTGGCACTTGATTTTGCATGTTGGTCGTTATATTGGATCATAGAAAAATCCATCTTGTTCATGAACTGGACC
AATTTGTTGTTTTTATGTGGTGGATGTACCGACACTAGCTTGTCCAAACATAAATCATTAGTTCTCTCACTTGCTTTGGTTGGTATGTTGAACTTGTGCT
GTTATATCTTTGGGATTTCCATCCAGTGTGAAAC
page-top