Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig13
Contig Information
Length 492 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16n03    rwhem16n03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_10366 [Oryza sativa Indica Group]
Score 392
Evalue 1.08373e-36
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig13
CTTGCAGAGATAGAGATTATGATAGCTGAACAAAAGAGCCGTGGAAAGGGACTAGGTCAAGAAGTGACCTTAATGATGATGTCGTTTGCAGTAGAGAAAT
ACGGAATTCACACTTTCAGAGCAAAAATTAGTGACTCAAATACTGCATCGTTAAAGCTCTTCAGGAAATTGGGCTTCAAGGATGCTTCCCATAGTGCAGT
TTTTAAGGAGGTGACACTGGAGGCGCCTGCAGCTGAACTCCCATTAAGCTCCCCTTTGACCATAGGAAGTTGGTGACATCTGTGATTATATGCCCCAAGA
TGTGTTGCAGTAGACATGCAATCAGTGGCTGGTCTTCACCAACTGATAGAAGCTAATTGTGTGCGCTATTTGGCATACTTAATGTAATGAGTACTGCCTT
CATCTGCCAACAACTGCTTGGGCCGATTGCGCACAGAGATATATAGCAATAATATGAAGAACCCTGTGTTGGATTGCTGAGCAAAAAAAAAA
page-top