Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig12
Contig Information
Length 538 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16o12    rwhem16o12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_027007 [Oryza sativa (japonica cultivar-group)]
Score 245
Evalue 1.58051e-19
Total Hit Count 58
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig12
TGGGATTGGTCAAGGAAGAAAAGGTGGAGATGAGGAGGCTGCGGATGAAGATGATCCTGAAGAGTATGAAGCAGAAGATGCTGCCCAGGGTGAGGATGGT
TTCTATGACAAAGCTGGAATGAGGCAAGGGAGAGGCCGAGGACGCGGTGGAAGAGGCCGGGGCCGGGGCCAGTACCATGGCCAGAGCCGGGACGGCGGGC
ACCCAATCGGCACTCCTCCATCGAATCACAGTGCTGAGCATCCGGTGGTGTCCAAGCCGCCTCCTGGTCCGCGTATGCCGGACGGCACAAAAGGATTTGC
CATGGGGCGAGGGAAGCCCCAGGTCAGCCCGGCAGTGCTGTCTGATGCTTAGTGGTACCCTGTTGCCCTGTTCTCGGGAGGGGTTGGCAGAACGGCGCTT
ATATGATGACCCATTTTGATGTGATCCCATGAAGAGGAAGGATAGTAATACCCTGATACATGCGTCAGTATACTGCATTACTGCTGGTCCATGGACCTGT
CTTTTGGTCTNTGAATTTCCTAGTTGAAAGTACAAATT
page-top